Sequence retrieval

Genome: Myxococcus xanthus DK 1622
Start position: 7812603
End position: 7812626
Length: 24

DNA sequence
>NC_008095, from 7812603 to 7812626 (24 bp); Myxococcus xanthus DK 1622 ACGGCTACTGCTTCGGCTTCGGCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF... 7812608-7814665	Sequence	MXAN_6334 - hypothetical protein (Protein is coded in complementary strand; from 7814665 to 7812608)