Sequence retrieval

Genome: Myxococcus xanthus DK 1622
Start position: 8431152
End position: 8431175
Length: 24

DNA sequence
>NC_008095, from 8431152 to 8431175 (24 bp); Myxococcus xanthus DK 1622 ACCCGAGCGCCCGAGCGCCCGAGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 8430502-8431236	Sequence	MXAN_6879 - short chain dehydrogenase/reductase oxidoreductase (Protein is coded in complementary strand; from 8431236 to 8430502)