Sequence retrieval

Genome: Myxococcus xanthus DK 1622
Start position: 8490385
End position: 8490408
Length: 24

DNA sequence
>NC_008095, from 8490385 to 8490408 (24 bp); Myxococcus xanthus DK 1622 TCCTTGACCTTGCCCTTGGCCTTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 8490235-8490426	Sequence	MXAN_6937 - CsbD family protein (Protein is coded in complementary strand; from 8490426 to 8490235)