Sequence retrieval

Genome: Myxococcus xanthus DK 1622
Start position: 8618263
End position: 8618286
Length: 24

DNA sequence
>NC_008095, from 8618263 to 8618286 (24 bp); Myxococcus xanthus DK 1622 CGGCGGCGGCGGCGGCAGTGGCGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 8617841-8619154	Sequence	MXAN_7042 - cyclic nucleotide-binding protein (Protein is coded in complementary strand; from 8619154 to 8617841)