Sequence retrieval

Genome: Myxococcus xanthus DK 1622
Start position: 8767216
End position: 8767239
Length: 24

DNA sequence
>NC_008095, from 8767216 to 8767239 (24 bp); Myxococcus xanthus DK 1622 GCGGCGGCGACGGGGGCGCCGGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 8766661-8767359	Sequence	MXAN_7184 - lipoprotein (Protein is coded in complementary strand; from 8767359 to 8766661)