Sequence retrieval

Genome: Myxococcus xanthus DK 1622
Start position: 8800395
End position: 8800418
Length: 24

DNA sequence
>NC_008095, from 8800395 to 8800418 (24 bp); Myxococcus xanthus DK 1622 CGCCACCGGCACCGGCACCGCCAC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 8798416-8800761	Sequence	MXAN_7208 - serine/threonine protein kinase (Protein is coded in complementary strand; from 8800761 to 8798416)