Sequence retrieval

Genome: Myxococcus xanthus DK 1622
Start position: 8881736
End position: 8881759
Length: 24

DNA sequence
>NC_008095, from 8881736 to 8881759 (24 bp); Myxococcus xanthus DK 1622 CACGCGCATGCGCAGGCGCAGGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 8879826-8883107	Sequence	MXAN_7274 - SNF2/helicase domain-containing protein (Protein is coded in complementary strand; from 8883107 to 8879826)