Sequence retrieval

Genome: Myxococcus xanthus DK 1622
Start position: 8993106
End position: 8993129
Length: 24

DNA sequence
>NC_008095, from 8993106 to 8993129 (24 bp); Myxococcus xanthus DK 1622 CGGGCGGACGGGCGGACGGGCGGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 8992446-8993279	Sequence	MXAN_7367 - hypothetical protein (Protein is coded in complementary strand; from 8993279 to 8992446)