Sequence retrieval

Genome: Myxococcus xanthus DK 1622
Start position: 6972029
End position: 6972053
Length: 25

DNA sequence
>NC_008095, from 6972029 to 6972053 (25 bp); Myxococcus xanthus DK 1622 CCGCTGCGCTCCGCTGCGCTCCGCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 6971358-6972758	Sequence	MXAN_5608 murF UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase (Protein is coded in complementary strand; from 6972758 to 6971358)