Sequence retrieval

Genome: Myxococcus xanthus DK 1622
Start position: 867245
End position: 867269
Length: 25

DNA sequence
>NC_008095, from 867245 to 867269 (25 bp); Myxococcus xanthus DK 1622 CGGGGCGGGACGGCGGGGGGCGGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 867145-869091	Sequence	MXAN_0759 - type II/IV secretion system ATPase (Protein is coded in complementary strand; from 869091 to 867145)