Sequence retrieval

Genome: Myxococcus xanthus DK 1622
Start position: 9099915
End position: 9099939
Length: 25

DNA sequence
>NC_008095, from 9099915 to 9099939 (25 bp); Myxococcus xanthus DK 1622 GCGAGGTGAGGTGAGGCGATGCGGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF.. 9098578-9099924	Sequence	MXAN_7471 - hypothetical protein
ORF... 9099934-9100959	Sequence	MXAN_7473 - hypothetical protein