Sequence retrieval

Genome: Myxococcus xanthus DK 1622
Start position: 187081
End position: 187107
Length: 27

DNA sequence
>NC_008095, from 187081 to 187107 (27 bp); Myxococcus xanthus DK 1622 GCCGGAGCCGCCGGTGCCGCCGGTGCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 186938-187396	Sequence	MXAN_0150 - hypothetical protein (Protein is coded in complementary strand; from 187396 to 186938)