Sequence retrieval

Genome: Myxococcus xanthus DK 1622
Start position: 2645932
End position: 2645958
Length: 27

DNA sequence
>NC_008095, from 2645932 to 2645958 (27 bp); Myxococcus xanthus DK 1622 CGCCGCCCACGCTGCCCACGCCGGCCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2644911-2647370	Sequence	MXAN_2278 - aspartate kinase (Protein is coded in complementary strand; from 2647370 to 2644911)