Sequence retrieval

Genome: Myxococcus xanthus DK 1622
Start position: 2887104
End position: 2887130
Length: 27

DNA sequence
>NC_008095, from 2887104 to 2887130 (27 bp); Myxococcus xanthus DK 1622 GTTGCTGCTGTTGCTGTTGTTGCTGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2885918-2887618	Sequence	MXAN_2479 rho transcription termination factor Rho (Protein is coded in complementary strand; from 2887618 to 2885918)