Sequence retrieval

Genome: Myxococcus xanthus DK 1622
Start position: 4885917
End position: 4885943
Length: 27

DNA sequence
>NC_008095, from 4885917 to 4885943 (27 bp); Myxococcus xanthus DK 1622 CCCCCGCCACCGCCGCCAGCCCCGCCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4875470-4889056	Sequence	MXAN_4000 - non-ribosomal peptide synthetase (Protein is coded in complementary strand; from 4889056 to 4875470)