Sequence retrieval

Genome: Myxococcus xanthus DK 1622
Start position: 5193959
End position: 5193985
Length: 27

DNA sequence
>NC_008095, from 5193959 to 5193985 (27 bp); Myxococcus xanthus DK 1622 GACGATGGCGACGATGCCGACGATGGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 5193882-5194220	Sequence	MXAN_4234 - hypothetical protein (Protein is coded in complementary strand; from 5194220 to 5193882)