Sequence retrieval

Genome: Myxococcus xanthus DK 1622
Start position: 5888012
End position: 5888038
Length: 27

DNA sequence
>NC_008095, from 5888012 to 5888038 (27 bp); Myxococcus xanthus DK 1622 CGGATGTCCCGGATGTTCGGGATGTCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 5887376-5888746	Sequence	MXAN_4699 - L-lysine 2,3-aminomutase (Protein is coded in complementary strand; from 5888746 to 5887376)