Sequence retrieval

Genome: Myxococcus xanthus DK 1622
Start position: 7049677
End position: 7049703
Length: 27

DNA sequence
>NC_008095, from 7049677 to 7049703 (27 bp); Myxococcus xanthus DK 1622 GGCGGCGTGGGCGGCGCGGGCGGCGAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 7049668-7051326	Sequence	MXAN_5687 - mechanosensitive ion channel MscS (Protein is coded in complementary strand; from 7051326 to 7049668)