Sequence retrieval

Genome: Myxococcus xanthus DK 1622
Start position: 865176
End position: 865202
Length: 27

DNA sequence
>NC_008095, from 865176 to 865202 (27 bp); Myxococcus xanthus DK 1622 CGCCGCCCGCGCCGCCTGCGCCGCCCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 864320-866344	Sequence	MXAN_0757 - hypothetical protein
ORF. 864407-866086	Sequence	MXAN_0756 - lipoprotein (Protein is coded in complementary strand; from 866086 to 864407)