Sequence retrieval

Genome: Myxococcus xanthus DK 1622
Start position: 1489904
End position: 1489933
Length: 30

DNA sequence
>NC_008095, from 1489904 to 1489933 (30 bp); Myxococcus xanthus DK 1622 GGGGCCAGCGGCGTCCAGCGGGGACCAGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1489549-1490628	Sequence	MXAN_1275 - radical SAM protein (Protein is coded in complementary strand; from 1490628 to 1489549)