Sequence retrieval

Genome: Myxococcus xanthus DK 1622
Start position: 2417745
End position: 2417774
Length: 30

DNA sequence
>NC_008095, from 2417745 to 2417774 (30 bp); Myxococcus xanthus DK 1622 GCGATGTCGATGGGGATGGCGAAGCCGATG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2417226-2418485	Sequence	MXAN_2084 - S1C family peptidase (Protein is coded in complementary strand; from 2418485 to 2417226)