Sequence retrieval

Genome: Myxococcus xanthus DK 1622
Start position: 2474890
End position: 2474919
Length: 30

DNA sequence
>NC_008095, from 2474890 to 2474919 (30 bp); Myxococcus xanthus DK 1622 TCCAGGGCGCTCCAGGGGGCCCCGGGGCGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2473048-2475432	Sequence	MXAN_2141 - EndA/NucM family protease / nuclease (Protein is coded in complementary strand; from 2475432 to 2473048)