Sequence retrieval

Genome: Myxococcus xanthus DK 1622
Start position: 6944820
End position: 6944849
Length: 30

DNA sequence
>NC_008095, from 6944820 to 6944849 (30 bp); Myxococcus xanthus DK 1622 CACCACCACCGCCGCCACCACCATCCCCAC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 6943918-6945444	Sequence	MXAN_5590 - S54 family peptidase (Protein is coded in complementary strand; from 6945444 to 6943918)