Sequence retrieval

Genome: Myxococcus xanthus DK 1622
Start position: 790272
End position: 790301
Length: 30

DNA sequence
>NC_008095, from 790272 to 790301 (30 bp); Myxococcus xanthus DK 1622 CAGCAGCAACAGCAGCAGCAACAGCAACAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 788853-790334	Sequence	MXAN_0691 - hypothetical protein (Protein is coded in complementary strand; from 790334 to 788853)
ORF. 790015-790380	Sequence	MXAN_0694 - hypothetical protein