Sequence retrieval

Genome: Myxococcus xanthus DK 1622
Start position: 7904731
End position: 7904760
Length: 30

DNA sequence
>NC_008095, from 7904731 to 7904760 (30 bp); Myxococcus xanthus DK 1622 CCCTCCGCGCACCTCCGCGTCCAGCCGCGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 7904645-7914193	Sequence	MXAN_6419 - hypothetical protein (Protein is coded in complementary strand; from 7914193 to 7904645)