Sequence retrieval

Genome: Myxococcus xanthus DK 1622
Start position: 852340
End position: 852369
Length: 30

DNA sequence
>NC_008095, from 852340 to 852369 (30 bp); Myxococcus xanthus DK 1622 GCCAGCGCCAGTCCCAGCGCCAGCCCCAGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 851704-852798	Sequence	MXAN_0746 - hypothetical protein (Protein is coded in complementary strand; from 852798 to 851704)