Sequence retrieval

Genome: Myxococcus xanthus DK 1622
Start position: 8699464
End position: 8699493
Length: 30

DNA sequence
>NC_008095, from 8699464 to 8699493 (30 bp); Myxococcus xanthus DK 1622 CGGAAAGCGGCGGCATGCGGCGGGAAGCGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 8698766-8700433	Sequence	MXAN_7125 - hypothetical protein (Protein is coded in complementary strand; from 8700433 to 8698766)