Sequence retrieval

Genome: Myxococcus xanthus DK 1622
Start position: 4709119
End position: 4709154
Length: 36

DNA sequence
>NC_008095, from 4709119 to 4709154 (36 bp); Myxococcus xanthus DK 1622 ACGCCGCCGACCACGCCACCCACCACCCCGCCCACC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4708768-4709667	Sequence	MXAN_3915 - TonB family protein (Protein is coded in complementary strand; from 4709667 to 4708768)