Sequence retrieval

Genome: Myxococcus xanthus DK 1622
Start position: 7132621
End position: 7132656
Length: 36

DNA sequence
>NC_008095, from 7132621 to 7132656 (36 bp); Myxococcus xanthus DK 1622 GCCCCAGCTCCTGCTCCAGCTCCTGCTCCAGCGCCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 7131039-7134134	Sequence	MXAN_5763 - OMP85 family outer membrane protein (Protein is coded in complementary strand; from 7134134 to 7131039)