Sequence retrieval

Genome: Myxococcus xanthus DK 1622
Start position: 755313
End position: 755348
Length: 36

DNA sequence
>NC_008095, from 755313 to 755348 (36 bp); Myxococcus xanthus DK 1622 CTCCGTCGCCGTCTCGGTCTCCGACTTCGTCTCCGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 754264-755697	Sequence	MXAN_0656 - hypothetical protein (Protein is coded in complementary strand; from 755697 to 754264)