Sequence retrieval

Genome: Myxococcus xanthus DK 1622
Start position: 794030
End position: 794065
Length: 36

DNA sequence
>NC_008095, from 794030 to 794065 (36 bp); Myxococcus xanthus DK 1622 GCGCCCAGGAGCACGCCCAGCAGCGCGCCCAGCAGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 792635-795082	Sequence	MXAN_0696 - permease (Protein is coded in complementary strand; from 795082 to 792635)