Sequence retrieval

Genome: Myxococcus xanthus DK 1622
Start position: 2180243
End position: 2180287
Length: 45

DNA sequence
>NC_008095, from 2180243 to 2180287 (45 bp); Myxococcus xanthus DK 1622 CCGCCTTCCTCGGTGCCGGCGTCCACGGTGCCGGCGTCCACGGTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2180234-2180527	Sequence	MXAN_1858 - hypothetical protein (Protein is coded in complementary strand; from 2180527 to 2180234)