Sequence retrieval

Genome: Myxococcus xanthus DK 1622
Start position: 3524859
End position: 3524903
Length: 45

DNA sequence
>NC_008095, from 3524859 to 3524903 (45 bp); Myxococcus xanthus DK 1622 AAGAAGGCCGCCGCCAAGAAGGCCGCCAAGAAGAAGCCTGCGGCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3523639-3527367	Sequence	MXAN_3002 - DNA protecting protein DprA/DNA topoisomerase I