Sequence retrieval

Genome: Myxococcus xanthus DK 1622
Start position: 4600386
End position: 4600430
Length: 45

DNA sequence
>NC_008095, from 4600386 to 4600430 (45 bp); Myxococcus xanthus DK 1622 CGCCTGGCCCACCTTCGCCTGGAGCGCCTTCGCCTGGCCCGTCAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4599748-4601274	Sequence	MXAN_3827 - hypothetical protein (Protein is coded in complementary strand; from 4601274 to 4599748)