Sequence retrieval

Genome: Myxococcus xanthus DK 1622
Start position: 5103471
End position: 5103515
Length: 45

DNA sequence
>NC_008095, from 5103471 to 5103515 (45 bp); Myxococcus xanthus DK 1622 GTCCTCATCCTCCCCGTCCTCGTCGTCGCCCTCCTCATCGTCCTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 5102635-5105058	Sequence	MXAN_4155 - hypothetical protein (Protein is coded in complementary strand; from 5105058 to 5102635)