Sequence retrieval

Genome: Myxococcus xanthus DK 1622
Start position: 5166224
End position: 5166268
Length: 45

DNA sequence
>NC_008095, from 5166224 to 5166268 (45 bp); Myxococcus xanthus DK 1622 GGCTCGACGCTCACGGGCTCGGCTCGCACGGGCTCGGCTCGCACG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 5165879-5169427	Sequence	MXAN_4210 rnr ribonuclease R (Protein is coded in complementary strand; from 5169427 to 5165879)