Sequence retrieval

Genome: Myxococcus xanthus DK 1622
Start position: 5519798
End position: 5519842
Length: 45

DNA sequence
>NC_008095, from 5519798 to 5519842 (45 bp); Myxococcus xanthus DK 1622 CGCCTTCTTCGCGGCGGACTTCTTCGTGGCAGCCTTCTTCGCGGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 5519595-5523515	Sequence	MXAN_4460 valS valyl-tRNA synthetase (Protein is coded in complementary strand; from 5523515 to 5519595)