Sequence retrieval

Genome: Myxococcus xanthus DK 1622
Start position: 6158432
End position: 6158476
Length: 45

DNA sequence
>NC_008095, from 6158432 to 6158476 (45 bp); Myxococcus xanthus DK 1622 GCCCGCGTCCGCCGCTCCCCCGTCCGCCTCTCCCCCGTCCGCCTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 6158070-6159626	Sequence	MXAN_4924 - hypothetical protein (Protein is coded in complementary strand; from 6159626 to 6158070)