Sequence retrieval

Genome: Myxococcus xanthus DK 1622
Start position: 7760907
End position: 7760951
Length: 45

DNA sequence
>NC_008095, from 7760907 to 7760951 (45 bp); Myxococcus xanthus DK 1622 GCCCACCTCGGCGGCGACGACGTCGGCGGCGCCCACGTCCGCGGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 7759732-7761237	Sequence	MXAN_6283 - hypothetical protein (Protein is coded in complementary strand; from 7761237 to 7759732)