Sequence retrieval

Genome: Myxococcus xanthus DK 1622
Start position: 8265692
End position: 8265736
Length: 45

DNA sequence
>NC_008095, from 8265692 to 8265736 (45 bp); Myxococcus xanthus DK 1622 GGAGGTGCGACGGGCGGTGGCGCGACGGGCCGAGGTGCCCCGGGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 8265606-8266082	Sequence	MXAN_6723 - hypothetical protein (Protein is coded in complementary strand; from 8266082 to 8265606)