Sequence retrieval

Genome: Myxococcus xanthus DK 1622
Start position: 839757
End position: 839801
Length: 45

DNA sequence
>NC_008095, from 839757 to 839801 (45 bp); Myxococcus xanthus DK 1622 CGCGTGTCCAGCGAGCGTGTCTCCAGCGAGCTTGTCTCCAGCGAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 838065-839960	Sequence	MXAN_0735 - hypothetical protein (Protein is coded in complementary strand; from 839960 to 838065)