Sequence retrieval

Genome: Myxococcus xanthus DK 1622
Start position: 8552157
End position: 8552201
Length: 45

DNA sequence
>NC_008095, from 8552157 to 8552201 (45 bp); Myxococcus xanthus DK 1622 TTGGTGGACAGGCCGTTCGTCGACAAGCCGTTCGTCGACAGCCCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 8551398-8552423	Sequence	MXAN_6993 - hypothetical protein (Protein is coded in complementary strand; from 8552423 to 8551398)