Sequence retrieval

Genome: Myxococcus xanthus DK 1622
Start position: 3976461
End position: 3976514
Length: 54

DNA sequence
>NC_008095, from 3976461 to 3976514 (54 bp); Myxococcus xanthus DK 1622 TGATCGCCGTGCTTGGCGTGCTCGCCGTGGCTGGCGTGCTCGCCGTGCTTGGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3976119-3976592	Sequence	MXAN_3421 - hypothetical protein (Protein is coded in complementary strand; from 3976592 to 3976119)