Sequence retrieval

Genome: Myxococcus xanthus DK 1622
Start position: 8152305
End position: 8152358
Length: 54

DNA sequence
>NC_008095, from 8152305 to 8152358 (54 bp); Myxococcus xanthus DK 1622 GGCCTTCTTCGCCGCCGCGGACTTCTTCGCCACCGCGGACTTCTTCGCGGGCGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 8152011-8152484	Sequence	MXAN_6623 - hypothetical protein (Protein is coded in complementary strand; from 8152484 to 8152011)
ORF. 8152294-8153118	Sequence	MXAN_6624 - AhpC/TSA family protein (Protein is coded in complementary strand; from 8153118 to 8152294)