Sequence retrieval

Genome: Myxococcus xanthus DK 1622
Start position: 8233669
End position: 8233722
Length: 54

DNA sequence
>NC_008095, from 8233669 to 8233722 (54 bp); Myxococcus xanthus DK 1622 CCGCCCGTAGTGCCCGAGCCGCCCGCAGTGCCCGAGCCGCCCGCAGTGCCCGAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 8231626-8234199	Sequence	MXAN_6692 difE histidine kinase DifE (Protein is coded in complementary strand; from 8234199 to 8231626)