Sequence retrieval

Genome: Myxococcus xanthus DK 1622
Start position: 1707203
End position: 1707262
Length: 60

DNA sequence
>NC_008095, from 1707203 to 1707262 (60 bp); Myxococcus xanthus DK 1622 GCCGCCGACCACGCCGCCAATCACACCACCGACCACGCCACCGACGACGCCGCCGACCAC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1706892-1707644	Sequence	MXAN_1449 - TonB protein (Protein is coded in complementary strand; from 1707644 to 1706892)