Sequence retrieval

Genome: Shewanella frigidimarina NCIMB 400
Start position: 1457291
End position: 1457314
Length: 24

DNA sequence
>NC_008345, from 1457291 to 1457314 (24 bp); Shewanella frigidimarina NCIMB 400 TATTGGTATTAGTACTGGTATTCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1455490-1457568	Sequence	Sfri_1230 - hypothetical protein (Protein is coded in complementary strand; from 1457568 to 1455490)