Sequence retrieval

Genome: Shewanella frigidimarina NCIMB 400
Start position: 2748406
End position: 2748429
Length: 24

DNA sequence
>NC_008345, from 2748406 to 2748429 (24 bp); Shewanella frigidimarina NCIMB 400 ATAGCAATAACAATACCAAGAGCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2748295-2748852	Sequence	Sfri_2302 - putative phosphohistidine phosphatase, SixA