Sequence retrieval

Genome: Shewanella frigidimarina NCIMB 400
Start position: 346893
End position: 346916
Length: 24

DNA sequence
>NC_008345, from 346893 to 346916 (24 bp); Shewanella frigidimarina NCIMB 400 GCAGCAGCACCAGCAGCGGCACCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 346128-347138	Sequence	Sfri_0318 - transketolase, central region (Protein is coded in complementary strand; from 347138 to 346128)