Sequence retrieval

Genome: Shewanella frigidimarina NCIMB 400
Start position: 3990511
End position: 3990534
Length: 24

DNA sequence
>NC_008345, from 3990511 to 3990534 (24 bp); Shewanella frigidimarina NCIMB 400 GAAGCTGAAGCTGAAGCTGAAGCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3990055-3990576	Sequence	Sfri_3342 - hypothetical protein (Protein is coded in complementary strand; from 3990576 to 3990055)